AAV pCAG-mRuby3-WPRE
(Plasmid #107744)

• Purpose: Can be used to express mRuby3. Can also be used to create adeno-associated virus for delivery of the mRuby3 sequence.
• Depositing Lab: Rylan Larsen
• Publication: Zhuang et al Cell Rep. 2021 Oct 12;37(2):109826. doi: 10.1016/j.celrep.2021.109826.

Backbone

• Vector backbone: AAV pCAG-FLEX-tdTomato-WPRE (#51503)
• Backbone manufacturer: Hongkui Zeng/Allen Institute For Brain Science
• Backbone size w/o insert (bp): 5396
• Total vector size (bp): 6270
• Modifications to backbone: A fragment containing mRuby3 was swapped into replace tdTomato and the LoxP sites in the original backbone.
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mRuby3
• Alt name: monomeric ruby3
• Alt name: mRuby3 red fluorescent protein
• Insert Size (bp): 874
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: TTCGGCTTCTGGCGTGTGAC
• 3′ sequencing primer: CCAGAGGTTGATTATCGATA

Resource Information

• Supplemental Documents:
  • Restriction Digest - SmaI
• A portion of this plasmid was derived from a plasmid made by: mRuby3 was synthesized de novo based on sequences published by Jun Chu's and Michael Lin's laboratories (Bajar et al, 2016, Nature Communications, PMID:26879144)
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry