Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #107744)


Item Catalog # Description Quantity Price (USD)
Plasmid 107744 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    AAV pCAG-FLEX-tdTomato-WPRE (#51503)
  • Backbone manufacturer
    Hongkui Zeng/Allen Institute For Brain Science
  • Backbone size w/o insert (bp) 5396
  • Total vector size (bp) 6270
  • Modifications to backbone
    A fragment containing mRuby3 was swapped into replace tdTomato and the LoxP sites in the original backbone.
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Alt name
    monomeric ruby3
  • Alt name
    mRuby3 red fluorescent protein
  • Insert Size (bp)
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
  • 3′ sequencing primer CCAGAGGTTGATTATCGATA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    mRuby3 was synthesized de novo based on sequences published by Jun Chu's and Michael Lin's laboratories (Bajar et al, 2016, Nature Communications, PMID:26879144)
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV pCAG-mRuby3-WPRE was a gift from Rylan Larsen (Addgene plasmid # 107744 ; ; RRID:Addgene_107744)