Skip to main content

pKM402
(Plasmid #107770)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107770 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUV15tet-O
  • Backbone manufacturer
    Sabine Ehrt and Dirk Schnappinger
  • Backbone size w/o insert (bp) 8026
  • Total vector size (bp) 8069
  • Modifications to backbone
    RecT inserted in place of GFP; Cam resistant marker inserted in place of Hyg resistance marker.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Kanamycin, 25 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Che9C RecT
  • Species
    mycobacterial
  • Insert Size (bp)
    1062
  • Promoter Ptet

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CACAGGCCCGGTGTGAGAAGGGTC
  • 3′ sequencing primer ATTGCCCGACATTATCGCGAGCCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    TetR (tet repressor)
  • Insert Size (bp)
    624
  • Promoter pTB21

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer GCGGCCGCTGATTAGCTAAGC
  • 3′ sequencing primer ATCCAGCTGAACGGTCTGGTT
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    cat
  • Alt name
    gene conferring chloramphenicol resistance
  • Insert Size (bp)
    660
  • Promoter Cat promoter

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site SwaI (not destroyed)
  • 3′ cloning site SwaI (not destroyed)
  • 5′ sequencing primer GCCTTCTTATTCGGCCTTGAATTG
  • 3′ sequencing primer GATTACGCGCAGAAAAAAAGGATC
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    kan
  • Alt name
    gene conferring kamamycin resistance
  • Insert Size (bp)
    816
  • Promoter kan promoter

Cloning Information for Gene/Insert 4

  • Cloning method Unknown
  • 5′ sequencing primer TTCGACGGGCCCAACGCATGA
  • 3′ sequencing primer TCTCCGAATCCAACTGGCTTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Graham Hatfull and Julia van Kessel, Pittsburgh Bacteriophage Institute, University of Pittsburgh, Pittsburgh, PA.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Induced with anhydrotetracycline, the plasmid can be used to introduce single base pair changes in the chromosomes of M. smegmatis and M. tuberculosis.

For original description of methodology, see:
van Kessel, J.C. & Hatfull, G.F. Efficient point mutagenesis in mycobacteria using single-stranded DNA recombineering: characterization of antimycobacterial drug targets.
Mol Microbiol 67, 1094-1107 (2008).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKM402 was a gift from Kenan Murphy (Addgene plasmid # 107770 ; http://n2t.net/addgene:107770 ; RRID:Addgene_107770)
  • For your References section:

    Mycobacterial recombineering. Murphy KC, Papavinasasundaram K, Sassetti CM. Methods Mol Biol. 2015;1285:177-99. doi: 10.1007/978-1-4939-2450-9_10. 10.1007/978-1-4939-2450-9_10 PubMed 25779316