pKM402
(Plasmid
#107770)
-
PurposeExpression of phage Che9c RecT for oligo-mediated recombineering in mycobacteria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107770 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUV15tet-O
-
Backbone manufacturerSabine Ehrt and Dirk Schnappinger
- Backbone size w/o insert (bp) 8026
- Total vector size (bp) 8069
-
Modifications to backboneRecT inserted in place of GFP; Cam resistant marker inserted in place of Hyg resistance marker.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Kanamycin, 25 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameChe9C RecT
-
Speciesmycobacterial
-
Insert Size (bp)1062
- Promoter Ptet
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CACAGGCCCGGTGTGAGAAGGGTC
- 3′ sequencing primer ATTGCCCGACATTATCGCGAGCCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTetR (tet repressor)
-
Insert Size (bp)624
- Promoter pTB21
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer GCGGCCGCTGATTAGCTAAGC
- 3′ sequencing primer ATCCAGCTGAACGGTCTGGTT (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namecat
-
Alt namegene conferring chloramphenicol resistance
-
Insert Size (bp)660
- Promoter Cat promoter
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site SwaI (not destroyed)
- 3′ cloning site SwaI (not destroyed)
- 5′ sequencing primer GCCTTCTTATTCGGCCTTGAATTG
- 3′ sequencing primer GATTACGCGCAGAAAAAAAGGATC (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namekan
-
Alt namegene conferring kamamycin resistance
-
Insert Size (bp)816
- Promoter kan promoter
Cloning Information for Gene/Insert 4
- Cloning method Unknown
- 5′ sequencing primer TTCGACGGGCCCAACGCATGA
- 3′ sequencing primer TCTCCGAATCCAACTGGCTTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGraham Hatfull and Julia van Kessel, Pittsburgh Bacteriophage Institute, University of Pittsburgh, Pittsburgh, PA.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Induced with anhydrotetracycline, the plasmid can be used to introduce single base pair changes in the chromosomes of M. smegmatis and M. tuberculosis.
For original description of methodology, see:
van Kessel, J.C. & Hatfull, G.F. Efficient point mutagenesis in mycobacteria using single-stranded DNA recombineering: characterization of antimycobacterial drug targets.
Mol Microbiol 67, 1094-1107 (2008).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKM402 was a gift from Kenan Murphy (Addgene plasmid # 107770 ; http://n2t.net/addgene:107770 ; RRID:Addgene_107770) -
For your References section:
Mycobacterial recombineering. Murphy KC, Papavinasasundaram K, Sassetti CM. Methods Mol Biol. 2015;1285:177-99. doi: 10.1007/978-1-4939-2450-9_10. 10.1007/978-1-4939-2450-9_10 PubMed 25779316