pKM402
(Plasmid #107770)

• Purpose: Expression of phage Che9c RecT for oligo-mediated recombineering in mycobacteria
• Depositing Lab: Kenan Murphy
• Publication: Murphy et al Methods Mol Biol. 2015;1285:177-99. doi: 10.1007/978-1-4939-2450-9_10.

Backbone

• Vector backbone: pUV15tet-O
• Backbone manufacturer: Sabine Ehrt and Dirk Schnappinger
• Backbone size w/o insert (bp): 8026
• Total vector size (bp): 8069
• Modifications to backbone: RecT inserted in place of GFP; Cam resistant marker inserted in place of Hyg resistance marker.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Kanamycin, 25 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Che9C RecT
• Species: mycobacterial
• Insert Size (bp): 1062
• Promoter: Ptet

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: CACAGGCCCGGTGTGAGAAGGGTC
• 3′ sequencing primer: ATTGCCCGACATTATCGCGAGCCC

Gene/Insert 2

• Gene/Insert name: TetR (tet repressor)
• Insert Size (bp): 624
• Promoter: pTB21

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: GCGGCCGCTGATTAGCTAAGC
• 3′ sequencing primer: ATCCAGCTGAACGGTCTGGTT

Gene/Insert 3

• Gene/Insert name: cat
• Alt name: gene conferring chloramphenicol resistance
• Insert Size (bp): 660
• Promoter: Cat promoter

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: SwaI (not destroyed)
• 3′ cloning site: SwaI (not destroyed)
• 5′ sequencing primer: GCCTTCTTATTCGGCCTTGAATTG
• 3′ sequencing primer: GATTACGCGCAGAAAAAAAGGATC

Gene/Insert 4

• Gene/Insert name: kan
• Alt name: gene conferring kamamycin resistance
• Insert Size (bp): 816
• Promoter: kan promoter

Cloning Information for Gene/Insert 4

• Cloning method: Unknown
• 5′ sequencing primer: TTCGACGGGCCCAACGCATGA
• 3′ sequencing primer: TCTCCGAATCCAACTGGCTTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Graham Hatfull and Julia van Kessel, Pittsburgh Bacteriophage Institute, University of Pittsburgh, Pittsburgh, PA.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Induced with anhydrotetracycline, the plasmid can be used to introduce single base pair changes in the chromosomes of M. smegmatis and M. tuberculosis.

For original description of methodology, see:
van Kessel, J.C. & Hatfull, G.F. Efficient point mutagenesis in mycobacteria using single-stranded DNA recombineering: characterization of antimycobacterial drug targets.
Mol Microbiol 67, 1094-1107 (2008).