-
PurposeBacterial expression of ilux for bioluminescence imaging
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107879 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEX(-)
- Backbone size w/o insert (bp) 4268
- Total vector size (bp) 10873
-
Modifications to backboneGST-deleted version of pGEX-6P-1
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameilux
-
SpeciesSynthetic
-
Insert Size (bp)6605
- Promoter tac
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGGTTCTGGCAAATATTCTGAA
- 3′ sequencing primer CATGTGTCAGAGGTTTTCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ilux pGEX(-) was a gift from Stefan Hell (Addgene plasmid # 107879 ; http://n2t.net/addgene:107879 ; RRID:Addgene_107879) -
For your References section:
Strongly enhanced bacterial bioluminescence with the ilux operon for single-cell imaging. Gregor C, Gwosch KC, Sahl SJ, Hell SW. Proc Natl Acad Sci U S A. 2018 Jan 30;115(5):962-967. doi: 10.1073/pnas.1715946115. Epub 2018 Jan 16. 10.1073/pnas.1715946115 PubMed 29339494