Skip to main content

pBEN276
(Plasmid #69150)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69150 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 69150-D50 50 μg of DNA in Tris buffer $495
DNA 69150-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pGRG25
  • Backbone manufacturer
    Nancy Craig - Johns Hopkins University (Addgene Plasmid #16665)
  • Backbone size w/o insert (bp) 12500
  • Total vector size (bp) 19671
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    luxCDABE
  • Species
    Photorhabdus luminescens
  • Insert Size (bp)
    6200
  • GenBank ID
    AF403784
  • Promoter frr

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer AATTGCCCGTCGTATTAAAG
  • 3′ sequencing primer GTAGCGTCGTAAGCTAATAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBEN276 was a gift from Pierre Germon (Addgene plasmid # 69150 ; http://n2t.net/addgene:69150 ; RRID:Addgene_69150)
  • For your References section:

    Development of stable reporter system cloning luxCDABE genes into chromosome of Salmonella enterica serotypes using Tn7 transposon. Howe K, Karsi A, Germon P, Wills RW, Lawrence ML, Bailey RH. BMC Microbiol. 2010 Jul 23;10:197. doi: 10.1186/1471-2180-10-197. 10.1186/1471-2180-10-197 PubMed 20653968