Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #68122)


Item Catalog # Description Quantity Price (USD)
Plasmid 68122 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Datsenko and Wanner, 2000
  • Backbone size w/o insert (bp) 6330
  • Total vector size (bp) 9647
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL1 Blue
  • Growth instructions
    Temperature sensitive origin.
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    flp recombinase
  • Insert Size (bp)
  • GenBank ID
  • Promoter rhamnose

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer tatgtcgtgattgagcggga
  • 3′ sequencing primer caccacaattcagcaaattgtg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Species
    E. coli
  • Insert Size (bp)
  • Promoter rhamnose

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ctcctcaatttcattacgaccag
  • 3′ sequencing primer GTCCGTTATGTAGGTAGGAATCT
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
  • Species
    E. coli
  • Insert Size (bp)
  • Promoter rhamnose

Cloning Information for Gene/Insert 3

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ttaagcagcaaacgggactg
  • 3′ sequencing primer TCAGATTCCTACCTACATAACGGAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSIJ8 was a gift from Alex Nielsen (Addgene plasmid # 68122 ; ; RRID:Addgene_68122)
  • For your References section:

    Seven gene deletions in seven days: Fast generation of Escherichia coli strains tolerant to acetate and osmotic stress. Jensen SI, Lennen RM, Herrgard MJ, Nielsen AT. Sci Rep. 2015 Dec 8;5:17874. doi: 10.1038/srep17874. 10.1038/srep17874 PubMed 26643270