pWT060f
              
              
                (Plasmid
                
                #107907)
              
            
            
            
          - 
            PurposeW2m.1-2 plasmid. Contains U6-sgRNA D (CCR5) and is ppart of the CAMERA2m system for cellular recording in mammalian cells
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107907 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepFYF1323
- 
              Vector typeMammalian Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameU6-sgRNA D (CCR5)
- 
                    gRNA/shRNA sequenceCACACTTGTCACCACCCCAA
- 
                    SpeciesSynthetic
Cloning Information
- Cloning method Unknown
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CloE1
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pWT060f was a gift from David Liu (Addgene plasmid # 107907 ; http://n2t.net/addgene:107907 ; RRID:Addgene_107907)
- 
                For your References section: Rewritable multi-event analog recording in bacterial and mammalian cells. Tang W, Liu DR. Science. 2018 Feb 15. pii: science.aap8992. doi: 10.1126/science.aap8992. 10.1126/science.aap8992 PubMed 29449507
 
    
