Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSirenRetroQ(puro)-shEgr4
(Plasmid #108117)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 108117 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSirenRetroQ(puro)
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6445
  • Total vector size (bp) 6508
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNA to Egr4
  • Alt name
    Early growth response 4
  • gRNA/shRNA sequence
    AAGTCTTTGGATGTGATGTTT
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Egr4 (a.k.a. NGF1-C, NGFI-C, NGFIC, pAT133)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer U6 fwd
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For the chosen sequence (AAGTCTTTGGATGTGATGTTT), the annealed oligos are:

5'-gatccAAGTCTTTGGATGTGATGTTTTTCAAGAGAAAACATCACATCCAAAGACTTTTTTTTACGCGTg-----3'

3'-----gTTCAGAAACCTACACTACAAAAAGTTCTCTTTTGTAGTGTAGGTTTCTGAAAAAAAATGCGCActtaa-5'

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSirenRetroQ(puro)-shEgr4 was a gift from Peter Johnson (Addgene plasmid # 108117 ; http://n2t.net/addgene:108117 ; RRID:Addgene_108117)
  • For your References section:

    An Arf-Egr-C/EBPbeta pathway linked to ras-induced senescence and cancer. Salotti J, Sakchaisri K, Tourtellotte WG, Johnson PF. Mol Cell Biol. 2015 Mar;35(5):866-83. doi: 10.1128/MCB.01489-14. Epub 2014 Dec 22. 10.1128/MCB.01489-14 PubMed 25535333