pF CAG BFP2 IRES neo
(Plasmid
#108175)
-
PurposeExpresses a blue fluorescent protein (BFP2) in mammalian cells along with conferring resistance to G418
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108175 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepF CAG luc IRES neo (Addgene plasmid # 98294)
-
Backbone manufacturerBrett Stringer
- Total vector size (bp) 11809
-
Modifications to backboneThe firefly luciferase gene of pF CAG luc IRES neo was removed by BamHI/NheI digestion and BamHI/NheI-digested BFP2, PCR-amplified from pBAD-mTagBFP2 (Addgene plasmid # 34632), was cloned in its place.
-
Vector typeMammalian Expression, Lentiviral ; Fluorescent protein
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsSingle colonies of transformed STBL3 or STBL4 cells cultured in 5 ml of LB broth containing 100 micrograms/ml ampicillin for 20 hours at 37oC, 200 rpm give good yields for plasmid minipreps.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBlue fluorescent protein (BFP2)
-
Alt nameBFP2
-
SpeciesSynthetic
-
Insert Size (bp)711
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GTCCCCTTCTCCATCTCCAG
- 3′ sequencing primer ACGCACACCGGCCTTATTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene plasmid34632
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pF CAG BFP2 IRES neo was a gift from Brett Stringer (Addgene plasmid # 108175 ; http://n2t.net/addgene:108175 ; RRID:Addgene_108175) -
For your References section:
A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma. Stringer BW, Day BW, D'Souza RCJ, Jamieson PR, Ensbey KS, Bruce ZC, Lim YC, Goasdoue K, Offenhauser C, Akgul S, Allan S, Robertson T, Lucas P, Tollesson G, Campbell S, Winter C, Do H, Dobrovic A, Inglis PL, Jeffree RL, Johns TG, Boyd AW. Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z. 10.1038/s41598-019-41277-z PubMed 30894629