Skip to main content

pIRESneo-FLAG/HA EYFP
(Plasmid #10825)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 10825 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pIRESneo
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 5328
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EYFP
  • Species
    Aequorea victoria
  • Insert Size (bp)
    726
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ggtaccgagctcggatcgat
  • 3′ sequencing primer agctgttggggtgagtactcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note that this plasmid was previously identified as pIRESneo-FLAG/HA EGFP from Meister et al., but the insert has been identified as EYFP, not EGFP. Addgene has changed the name and information for this plasmid based on this discovery.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIRESneo-FLAG/HA EYFP was a gift from Thomas Tuschl (Addgene plasmid # 10825 ; http://n2t.net/addgene:10825 ; RRID:Addgene_10825)
  • For your References section:

    Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Meister G, Landthaler M, Patkaniowska A, Dorsett Y, Teng G, Tuschl T. Mol Cell. 2004 Jul 23. 15(2):185-97. 10.1016/j.molcel.2004.07.007 PubMed 15260970