Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #108303)


Item Catalog # Description Quantity Price (USD)
Plasmid 108303 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5390
  • Total vector size (bp) 8252
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter lac
  • Tag / Fusion Protein
    • mH6 tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer atgggcaaaaaaatccatgcac
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

For commercial use, please contact Arbor Biotechnologies at [email protected].

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-MH6-EsCas13d was a gift from Arbor Biotechnologies (Addgene plasmid # 108303 ; ; RRID:Addgene_108303)
  • For your References section:

    Cas13d Is a Compact RNA-Targeting Type VI CRISPR Effector Positively Modulated by a WYL-Domain-Containing Accessory Protein. Yan WX, Chong S, Zhang H, Makarova KS, Koonin EV, Cheng DR, Scott DA. Mol Cell. 2018 Mar 9. pii: S1097-2765(18)30173-4. doi: 10.1016/j.molcel.2018.02.028. 10.1016/j.molcel.2018.02.028 PubMed 29551514