p006-GFP-strong
(Plasmid
#108313)
-
PurposeGFP from jellyfish Aquorea sp. under strong synthetic constitutive promoter pFAB4026; kanamycin resistant.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108313 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJ401
-
Backbone manufacturerDNA2.0
- Backbone size w/o insert (bp) 3976
- Total vector size (bp) 4503
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGreen fluorescent protein
-
Alt nameGFP
-
SpeciesAquorea victoria
-
Insert Size (bp)717
- Promoter pFAB4026
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTCGAAAATAATAAAGGGAAAATCAG
- 3′ sequencing primer CTCAGAAGTGAAACGCCGTA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDNA2.0, GFP comes from another plasmid pET EDNA GFP, pFAB promoter comes from the BIOFAB collection
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.06.20.449138v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p006-GFP-strong was a gift from Jaroslaw Bryk (Addgene plasmid # 108313 ; http://n2t.net/addgene:108313 ; RRID:Addgene_108313) -
For your References section:
UNIGEMS: plasmids and parts to facilitate teaching on assembly, gene expression control and logic in E. coli. Siddall A, Williams AA, Sanders J, Denton JA, Madden D, Schollar J, Bryk J. bioRxiv 2021.06.20.449138 10.1101/2021.06.20.449138