p005-RFP-strong
              
              
                (Plasmid
                
                #108317)
              
            
            
            
          - 
            PurposeSynthetic RFP based on Corynactis spp under strong synthetic constitutive promoter pFAB4005; kanamycin resistant.
 - 
              Depositing Lab
 - 
          Publication
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108317 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepJ401
 - 
              Backbone manufacturerDNA2.0
 - Backbone size w/o insert (bp) 3654
 - Total vector size (bp) 4466
 - 
              Vector typeBacterial Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameRFP under controlf of strong synthetic constitutive promoter pFAB4005
 - 
                    SpeciesSynthetic; Corynactis
 - 
                  Insert Size (bp)813
 - Promoter pFAB4005
 
Cloning Information
- Cloning method Gibson Cloning
 - 5′ sequencing primer CTCGAAAATAATAAAGGGAAAATCAG
 - 3′ sequencing primer CTCAGAAGTGAAACGCCGTA (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 - 
            A portion of this plasmid was derived from a plasmid made byIt was synthesized by DNA2.0
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.06.20.449138v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
p005-RFP-strong was a gift from Jaroslaw Bryk (Addgene plasmid # 108317 ; http://n2t.net/addgene:108317 ; RRID:Addgene_108317) - 
                
For your References section:
UNIGEMS: plasmids and parts to facilitate teaching on assembly, gene expression control and logic in E. coli. Siddall A, Williams AA, Sanders J, Denton JA, Madden D, Schollar J, Bryk J. bioRxiv 2021.06.20.449138 10.1101/2021.06.20.449138