CBh-dCas9-Mll3SET
(Plasmid
#108452)
-
PurposeExpression vector of CRISPR/dCas9 fused with SET domain of mouse MLL3 gene, driven by CBh promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108452 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV7
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9, MLL3
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_001081383
-
Entrez GeneKmt2c (a.k.a. E330008K23Rik, HALR, Mll3)
- Promoter CBh
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer CGTTACATAACTTACGGTAA
- 3′ sequencing primer ATCATGATCCTTGTAGTCT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGenescript Synthesis
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CBh-dCas9-Mll3SET was a gift from Bing Ren (Addgene plasmid # 108452 ; http://n2t.net/addgene:108452 ; RRID:Addgene_108452) -
For your References section:
Histone H3 lysine 4 monomethylation modulates long-range chromatin interactions at enhancers. Yan J, Chen SA, Local A, Liu T, Qiu Y, Dorighi KM, Preissl S, Rivera CM, Wang C, Ye Z, Ge K, Hu M, Wysocka J, Ren B. Cell Res. 2018 Jan 9. pii: cr20181. doi: 10.1038/cr.2018.1. 10.1038/cr.2018.1 PubMed 29313530