Skip to main content
Addgene
Open Menu

pSM-Prig3-wArchon1-GFP
(Plasmid #108465)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 108465 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSM
  • Total vector size (bp) 7909
  • Vector type
    Worm Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    wArchon1
  • Species
    Synthetic
  • Insert Size (bp)
    759
  • Promoter rig-3
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Asp718I (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer gccaaaggacccaaaggtat
  • 3′ sequencing primer gagcacagggagaaagagca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSM-Prig3-wArchon1-GFP was a gift from Steven Flavell (Addgene plasmid # 108465)

  • For your References section:

    A robotic multidimensional directed evolution approach applied to fluorescent voltage reporters. Piatkevich KD, Jung EE, Straub C, Linghu C, Park D, Suk HJ, Hochbaum DR, Goodwin D, Pnevmatikakis E, Pak N, Kawashima T, Yang CT, Rhoades JL, Shemesh O, Asano S, Yoon YG, Freifeld L, Saulnier JL, Riegler C, Engert F, Hughes T, Drobizhev M, Szabo B, Ahrens MB, Flavell SW, Sabatini BL, Boyden ES. Nat Chem Biol. 2018 Feb 26. pii: 10.1038/s41589-018-0004-9. doi: 10.1038/s41589-018-0004-9. 10.1038/s41589-018-0004-9 PubMed 29483642
Related items: