-
PurposeLentivirus vector expessing Cre under EF1a promoter and puromycin under PGK promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108543 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namecre recombinase
- Promoter EF1apha
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer CATTAAAGCAGCGTATCC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePuromycin
- Promoter PGK
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer CATTAAAGCAGCGTATCC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-EF1-Cre-PGK-Puro was a gift from Javier Alcudia (Addgene plasmid # 108543 ; http://n2t.net/addgene:108543 ; RRID:Addgene_108543)