pAN19-3xFLAG-ccvTIR1-NOSt
              
              
                (Plasmid
                
                #108546)
              
            
            
            
          - 
            PurposeCloning vector including N-terminally 3xFLAG-tagged Arabidopsis auxin receptor TIR1 with the F79G mutation [ccvTIR1] and NOS terminator
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108546 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepAN19
 - Backbone size w/o insert (bp) 2700
 - Total vector size (bp) 5000
 - 
              Vector typeCloning vector
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameTRANSPORT INHIBITOR RESPONSE 1 [F79G] fused with 3xFLAG and NOS terminator
 - 
                  Alt nameccvTIR1
 - 
                    SpeciesA. thaliana (mustard weed)
 - 
                  Insert Size (bp)2118
 - 
                  MutationChanged F79 to G
 - 
                        Entrez GeneTIR1 (a.k.a. AT3G62980, AtTIR1, TRANSPORT INHIBITOR RESPONSE 1)
 - 
    
        Tag
        / Fusion Protein
    
- 3xFLAG (N terminal on insert)
 
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site SmaI (not destroyed)
 - 3′ cloning site EcoRI (not destroyed)
 - 5′ sequencing primer gccgattcattaatgcagctg
 - 3′ sequencing primer AAGGGGGATGTGCTGCAAGG (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pAN19-3xFLAG-ccvTIR1-NOSt was a gift from Keiko Torii (Addgene plasmid # 108546 ; http://n2t.net/addgene:108546 ; RRID:Addgene_108546) - 
                
For your References section:
Chemical hijacking of auxin signaling with an engineered auxin-TIR1 pair. Uchida N, Takahashi K, Iwasaki R, Yamada R, Yoshimura M, Endo TA, Kimura S, Zhang H, Nomoto M, Tada Y, Kinoshita T, Itami K, Hagihara S, Torii KU. Nat Chem Biol. 2018 Mar;14(3):299-305. doi: 10.1038/nchembio.2555. Epub 2018 Jan 22. 10.1038/nchembio.2555 PubMed 29355850