pGEX4T2 RANK-L
(Plasmid
#108571)
-
PurposeEncodes C-terminal part of RANKL (aa158-aa316) with a GST N-terminal tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108571 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGEX4T2
-
Backbone manufacturerGE Healthcare Life Sciences
- Backbone size w/o insert (bp) 4970
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRANKL (receptor activator of nuclear factor kappa-B ligand)
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)480
-
Mutationaa158-aa316
-
GenBank IDNM_011613.3
-
Entrez GeneTnfsf11 (a.k.a. Ly109l, ODF, OPGL, RANKL, Trance)
- Promoter Ptac (trp/lac)
-
Tag
/ Fusion Protein
- GST (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GCAAGCTACCTGAAATGCTG
- 3′ sequencing primer ATACACTCCGCTATCGCTAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX4T2 RANK-L was a gift from Jean-Claude Scimeca (Addgene plasmid # 108571 ; http://n2t.net/addgene:108571 ; RRID:Addgene_108571) -
For your References section:
Differential binding of poly(ADP-Ribose) polymerase-1 and JunD/Fra2 accounts for RANKL-induced Tcirg1 gene expression during osteoclastogenesis. Beranger GE, Momier D, Guigonis JM, Samson M, Carle GF, Scimeca JC. J Bone Miner Res. 2007 Jul;22(7):975-83. doi: 10.1359/jbmr.070406. 10.1359/jbmr.070406 PubMed 17419679