Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGEX4T2 RANK-L
(Plasmid #108571)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 108571 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEX4T2
  • Backbone manufacturer
    GE Healthcare Life Sciences
  • Backbone size w/o insert (bp) 4970
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RANKL (receptor activator of nuclear factor kappa-B ligand)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    480
  • Mutation
    aa158-aa316
  • GenBank ID
    NM_011613.3
  • Entrez Gene
    Tnfsf11 (a.k.a. Ly109l, ODF, OPGL, RANKL, Trance)
  • Promoter Ptac (trp/lac)
  • Tag / Fusion Protein
    • GST (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GCAAGCTACCTGAAATGCTG
  • 3′ sequencing primer ATACACTCCGCTATCGCTAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX4T2 RANK-L was a gift from Jean-Claude Scimeca (Addgene plasmid # 108571 ; http://n2t.net/addgene:108571 ; RRID:Addgene_108571)
  • For your References section:

    Differential binding of poly(ADP-Ribose) polymerase-1 and JunD/Fra2 accounts for RANKL-induced Tcirg1 gene expression during osteoclastogenesis. Beranger GE, Momier D, Guigonis JM, Samson M, Carle GF, Scimeca JC. J Bone Miner Res. 2007 Jul;22(7):975-83. doi: 10.1359/jbmr.070406. 10.1359/jbmr.070406 PubMed 17419679