pTol2-hsp70l:Cas9-t2A-GFP, 5xU6:sgRNA
(Plasmid #108871)

• Purpose: Expression of heat shock inducible Cas9-GFP and U6-driven 5 individual gRNAs for scGESTALT in zebrafish
• Depositing Lab: Alex Schier
• Publication: Raj et al Nat Biotechnol. 2018 Mar 28. pii: nbt.4103. doi: 10.1038/nbt.4103.

Backbone

• Vector backbone: Tol2
• Backbone size w/o insert (bp): 5853
• Total vector size (bp): 13822
• Vector type: CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Due to size of vector, bacteria are slow growing. Grow larger cultures for high plasmid recovery.
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: 5xU6:sgRNA
• Species: D. rerio (zebrafish), Synthetic
• Insert Size (bp): 2693
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: ClaI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: ACATTAAATGAAATGCATcagt

Gene/Insert 2

• Gene/Insert name: Cas9-t2A-GFP
• Species: D. rerio (zebrafish)
• Insert Size (bp): 5276
• Promoter: hsp70

Cloning Information for Gene/Insert 2

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TTACTTGTACAGCTCGTCCATGCC

Resource Information

• Supplemental Documents:
  • pTol2-hsp70l:Cas9-t2A-GFP, 5xU6:sgRNA.txt

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry