-
PurposescGESTALT V7 lineage barcode for zebrafish
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108870 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneTol2
- Backbone size w/o insert (bp) 10385
-
Vector typeTol2 integration into zebrafish genome
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namescGESTALT lineage tracing target V7
-
Alt nameDRv7scGstlt
-
SpeciesSynthetic
-
Insert Size (bp)324
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCCGGACTCAGATCTCGAGCTCAAGCTT
- 3′ sequencing primer CTGCCATTTGTCTCGAGGTCGAGAATTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTol2-hspDRv7_scGstlt was a gift from Alex Schier (Addgene plasmid # 108870 ; http://n2t.net/addgene:108870 ; RRID:Addgene_108870) -
For your References section:
Simultaneous single-cell profiling of lineages and cell types in the vertebrate brain. Raj B, Wagner DE, McKenna A, Pandey S, Klein AM, Shendure J, Gagnon JA, Schier AF. Nat Biotechnol. 2018 Mar 28. pii: nbt.4103. doi: 10.1038/nbt.4103. 10.1038/nbt.4103 PubMed 29608178