pLG1-puro-sgATL3-2
(Plasmid
#109010)
-
PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 109010 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCRISPRia-v2
-
Backbone manufacturerJonathan Weissman, Addgene #84840
- Backbone size w/o insert (bp) 8200
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin ; BFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATL3-sgRNA #2
-
gRNA/shRNA sequenceGAGCAGGGGTGCAGAGGAGA
-
SpeciesH. sapiens (human)
-
Entrez GeneATL3 (a.k.a. HSN1F)
- Promoter mU6 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstX1 (not destroyed)
- 3′ cloning site BlpI (not destroyed)
- 5′ sequencing primer gcgccaattctgcagacaaa
- 3′ sequencing primer CCTTCTCTAGGCACCGGTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLG1-puro-sgATL3-2 was a gift from Jacob Corn (Addgene plasmid # 109010 ; http://n2t.net/addgene:109010 ; RRID:Addgene_109010) -
For your References section:
Atlastins remodel the endoplasmic reticulum for selective autophagy. Liang JR, Lingeman E, Ahmed S, Corn JE. J Cell Biol. 2018 Aug 24. pii: jcb.201804185. doi: 10.1083/jcb.201804185. 10.1083/jcb.201804185 PubMed 30143524