Skip to main content

pLKO.1-puro-shNT
(Plasmid #109012)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 109012 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1 puro
  • Backbone manufacturer
    Bob Weinberg, Addgene #8453
  • Backbone size w/o insert (bp) 7032
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Non-targeting shRNA
  • gRNA/shRNA sequence
    CCTAAGGTTAAGTCGCCCTCG
  • Species
    H. sapiens (human)
  • Promoter hU6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-puro-shNT was a gift from Jacob Corn (Addgene plasmid # 109012 ; http://n2t.net/addgene:109012 ; RRID:Addgene_109012)
  • For your References section:

    Atlastins remodel the endoplasmic reticulum for selective autophagy. Liang JR, Lingeman E, Ahmed S, Corn JE. J Cell Biol. 2018 Aug 24. pii: jcb.201804185. doi: 10.1083/jcb.201804185. 10.1083/jcb.201804185 PubMed 30143524