Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pET22b-ecDHFR
(Plasmid #109055)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 109055 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET22b
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5493
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ecDHFR
  • Alt name
    dihydrofolate reductase
  • Alt name
    folA
  • Species
    E.coli
  • Insert Size (bp)
    480
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET22b-ecDHFR was a gift from Stephen Benkovic (Addgene plasmid # 109055 ; http://n2t.net/addgene:109055 ; RRID:Addgene_109055)
  • For your References section:

    Evidence for a functional role of the dynamics of glycine-121 of Escherichia coli dihydrofolate reductase obtained from kinetic analysis of a site-directed mutant. Cameron CE, Benkovic SJ. Biochemistry. 1997 Dec 16;36(50):15792-800. doi: 10.1021/bi9716231. 10.1021/bi9716231 PubMed 9398309