Skip to main content

pHS18 (mANGPTL3-Strep)
(Plasmid #109111)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 109111 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pcDNA6
  • Backbone size w/o insert (bp) 4989
  • Total vector size (bp) 6348
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ANGPTL3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1389
  • Entrez Gene
    Angptl3 (a.k.a. hypl)
  • Promoter CMV
  • Tag / Fusion Protein
    • StrepII (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer AGGAAAGGACAGTGGGAGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

21bp deletion in the SV40 promoter sequence. May affect blasticidin selection.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHS18 (mANGPTL3-Strep) was a gift from Brandon Davies (Addgene plasmid # 109111 ; http://n2t.net/addgene:109111 ; RRID:Addgene_109111)
  • For your References section:

    ANGPTL8 promotes the ability of ANGPTL3 to bind and inhibit lipoprotein lipase. Chi X, Britt EC, Shows HW, Hjelmaas AJ, Shetty SK, Cushing EM, Li W, Dou A, Zhang R, Davies BSJ. Mol Metab. 2017 Oct;6(10):1137-1149. doi: 10.1016/j.molmet.2017.06.014. Epub 2017 Jun 29. 10.1016/j.molmet.2017.06.014 PubMed 29031715