1375_pAAV-U6-SA-WTmLdlrEx14-gRNA2-N22-CB-SACas9-HA-OLLAS-spA
(Plasmid
#109311)
-
PurposePlasmid for AAV SaCas9 Mammalian Expression with a gRNA against Ldlr
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 109311 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEMBL8
- Total vector size (bp) 7165
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLdlr gRNA
-
gRNA/shRNA sequenceGGGCAGGCGCAGGTGAATTTGG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer CCTTCATATTTGCATATACGATACAAGGCTGTTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySaCas9 was cloned from Addgene #61593
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1375_pAAV-U6-SA-WTmLdlrEx14-gRNA2-N22-CB-SACas9-HA-OLLAS-spA was a gift from William Lagor (Addgene plasmid # 109311 ; http://n2t.net/addgene:109311 ; RRID:Addgene_109311) -
For your References section:
Somatic Editing of Ldlr With Adeno-Associated Viral-CRISPR Is an Efficient Tool for Atherosclerosis Research. Jarrett KE, Lee C, De Giorgi M, Hurley A, Gillard BK, Doerfler AM, Li A, Pownall HJ, Bao G, Lagor WR. Arterioscler Thromb Vasc Biol. 2018 Jul 19. pii: ATVBAHA.118.311221. doi: 10.1161/ATVBAHA.118.311221. 10.1161/ATVBAHA.118.311221 PubMed 30026278