pSCBe
(Plasmid
#110065)
-
Purpose(Empty Backbone) Trc1O promoter express gene in Synechocystis 6803
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110065 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSCBe
- Backbone size (bp) 6633
-
Vector typeBacterial Expression
- Promoter Trc1O
-
Tags
/ Fusion Proteins
- 5' end FLAG tag
- 3' end His tag
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GTAACGCGCTTGCTGCTTGG
- 3′ sequencing primer GTTCATAGCGGTCTCGGGTTC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSCBe was a gift from Devaki Bhaya (Addgene plasmid # 110065 ; http://n2t.net/addgene:110065 ; RRID:Addgene_110065)