Skip to main content

pEGFP-N1_MeCP2(deltaN)
(Plasmid #110189)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110189 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3938
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MeCP2_e2 delta N (mouse cDNA) _EGFP
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2092
  • Mutation
    delta N terminus
  • Entrez Gene
    Mecp2 (a.k.a. 1500041B07Rik, D630021H01Rik, Mbd5, WBP10)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer aaatgtcgtaacaactccgc
  • 3′ sequencing primer acaaaccacaactagaatgcag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-N1_MeCP2(deltaN) was a gift from Adrian Bird (Addgene plasmid # 110189 ; http://n2t.net/addgene:110189 ; RRID:Addgene_110189)
  • For your References section:

    Radically truncated MeCP2 rescues Rett syndrome-like neurological defects. Tillotson R, Selfridge J, Koerner MV, Gadalla KKE, Guy J, De Sousa D, Hector RD, Cobb SR, Bird A. Nature. 2017 Oct 19;550(7676):398-401. doi: 10.1038/nature24058. Epub 2017 Oct 11. 10.1038/nature24058 PubMed 29019980