pATLIC
(Plasmid
#110287)
-
PurposeA backbone vector for cell surface display in E. coli by Ligation Independent Cloning (LIC)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110287 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBAD
- Backbone size w/o insert (bp) 3986
- Total vector size (bp) 5519
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameyfaL
-
Alt nameautotransporter
-
SpeciesE. coli
-
Insert Size (bp)1533
-
GenBank IDAAA74094
- Promoter araBAD promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GAAGGAGATATAAGGATGCGGATTATCTTTCTACGCAAG
- 3′ sequencing primer ATGATGGTGATGGTGCCATTTCACCGTCATCGACAAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene QC finds S92G, G99S, and K330R mutations in yfaL as well as a stop codon inserted before the His tag. The depositor notes these are not of functional concern
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pATLIC was a gift from In-Geol Choi (Addgene plasmid # 110287 ; http://n2t.net/addgene:110287 ; RRID:Addgene_110287) -
For your References section:
Functional cell surface display and controlled secretion of diverse Agarolytic enzymes by Escherichia coli with a novel ligation-independent cloning vector based on the autotransporter YfaL. Ko HJ, Park E, Song J, Yang TH, Lee HJ, Kim KH, Choi IG. Appl Environ Microbiol. 2012 May;78(9):3051-8. doi: 10.1128/AEM.07004-11. Epub 2012 Feb 17. 10.1128/AEM.07004-11 PubMed 22344647