Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

tet-pLKO.neo_shGFP
(Plasmid #110470)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 110470 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Tet-pLKO-neo
  • Backbone manufacturer
    #21916
  • Backbone size w/o insert (bp) 10959
  • Total vector size (bp) 9142
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP
  • gRNA/shRNA sequence
    CAAGCTGACCCTGAAGTTCAT
  • Species
    Synthetic
  • Promoter H1/TO (RNA PolIII)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGCAGGGATATTCACCATTATCGTTTCAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.

Plasmid grows more slowly than standard plasmids.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    tet-pLKO.neo_shGFP was a gift from Sandra Martha Gomes Dias (Addgene plasmid # 110470 ; http://n2t.net/addgene:110470 ; RRID:Addgene_110470)
  • For your References section:

    Dual inhibition of glutaminase and carnitine palmitoyltransferase decreases growth and migration of glutaminase inhibition-resistant triple-negative breast cancer cells. Reis LMD, Adamoski D, Ornitz Oliveira Souza R, Rodrigues Ascencao CF, Sousa de Oliveira KR, Correa-da-Silva F, Malta de Sa Patroni F, Meira Dias M, Consonni SR, Mendes de Moraes-Vieira PM, Silber AM, Dias SMG. J Biol Chem. 2019 Jun 14;294(24):9342-9357. doi: 10.1074/jbc.RA119.008180. Epub 2019 Apr 30. 10.1074/jbc.RA119.008180 PubMed 31040181