Skip to main content

pUCHR-osTIR1-IRES-GFP
(Plasmid #110661)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110661 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUCHR-IRES-GFP
  • Total vector size (bp) 9526
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    osTIR1
  • Species
    rice , but codon-optimized for mammalians
  • Insert Size (bp)
    1756
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe I (not destroyed)
  • 3′ cloning site Xma I (not destroyed)
  • 5′ sequencing primer CCACGCTGTTTTGACCTCCATAG
  • 3′ sequencing primer GGAGGGAGAGGGGCGGATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

osTIR1 was subclone into pUCHR-IRES-GFP plasmid from Addgene plasmid #72834

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUCHR-osTIR1-IRES-GFP was a gift from Dmitriy Mazurov (Addgene plasmid # 110661 ; http://n2t.net/addgene:110661 ; RRID:Addgene_110661)
  • For your References section:

    Isolation of gene-edited cells via knock-in of short glycophosphatidylinositol-anchored epitope tags. Zotova A, Pichugin A, Atemasova A, Knyazhanskaya E, Lopatukhina E, Mitkin N, Holmuhamedov E, Gottikh M, Kuprash D, Filatov A, Mazurov D. Sci Rep. 2019 Feb 28;9(1):3132. doi: 10.1038/s41598-019-40219-z. 10.1038/s41598-019-40219-z PubMed 30816313