Skip to main content

pEN35-CDKN2A-Ex2-L
(Plasmid #110736)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110736 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEN35
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CDKN2A gRNA
  • gRNA/shRNA sequence
    GTGGCGGGGTCGGCGCAGTTGGG
  • Species
    H. sapiens (human)
  • Entrez Gene
    CDKN2A (a.k.a. ARF, CAI2, CDK4I, CDKN2, CMM2, INK4, INK4A, MLM, MTS-1, MTS1, P14, P14ARF, P16, P16-INK4A, P16INK4, P16INK4A, P19, P19ARF, TP16)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEN35-CDKN2A-Ex2-L was a gift from Robert Judson-Torres (Addgene plasmid # 110736 ; http://n2t.net/addgene:110736 ; RRID:Addgene_110736)
  • For your References section:

    Bi-allelic Loss of CDKN2A Initiates Melanoma Invasion via BRN2 Activation. Zeng H, Jorapur A, Shain AH, Lang UE, Torres R, Zhang Y, McNeal AS, Botton T, Lin J, Donne M, Bastian IN, Yu R, North JP, Pincus L, Ruben BS, Joseph NM, Yeh I, Bastian BC, Judson RL. Cancer Cell. 2018 Jul 9;34(1):56-68.e9. doi: 10.1016/j.ccell.2018.05.014. 10.1016/j.ccell.2018.05.014 PubMed 29990501