Skip to main content
Addgene

Ubiquitin (1-76; T66V, L67N)
(Plasmid #110755)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110755 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET17b
  • Backbone manufacturer
    Merck
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    UBB
  • Species
    H. sapiens (human)
  • Mutation
    T66V, L67N
  • Entrez Gene
    UBB (a.k.a. HEL-S-50)
  • Promoter T7

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GGGTTATGCTAGTTATTGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    UBB (for monoUb): pET17b-Ub-wt-plasmid (originally cDNA of the UBC gene, identical to 99%)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Ubiquitin (1-76; T66V, L67N) was a gift from David Komander (Addgene plasmid # 110755 ; http://n2t.net/addgene:110755 ; RRID:Addgene_110755)
  • For your References section:

    An invisible ubiquitin conformation is required for efficient phosphorylation by PINK1. Gladkova C, Schubert AF, Wagstaff JL, Pruneda JN, Freund SM, Komander D. EMBO J. 2017 Dec 15;36(24):3555-3572. doi: 10.15252/embj.201797876. Epub 2017 Nov 13. 10.15252/embj.201797876 PubMed 29133469