Ubiquitin (1-76; T66V, L67N)
(Plasmid
#110755)
-
PurposeBacterial expression of human Ubiquitin (1-76; T66V, L67N)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110755 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET17b
-
Backbone manufacturerMerck
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameUBB
-
SpeciesH. sapiens (human)
-
MutationT66V, L67N
-
Entrez GeneUBB (a.k.a. HEL-S-50)
- Promoter T7
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GGGTTATGCTAGTTATTGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byUBB (for monoUb): pET17b-Ub-wt-plasmid (originally cDNA of the UBC gene, identical to 99%)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Ubiquitin (1-76; T66V, L67N) was a gift from David Komander (Addgene plasmid # 110755 ; http://n2t.net/addgene:110755 ; RRID:Addgene_110755) -
For your References section:
An invisible ubiquitin conformation is required for efficient phosphorylation by PINK1. Gladkova C, Schubert AF, Wagstaff JL, Pruneda JN, Freund SM, Komander D. EMBO J. 2017 Dec 15;36(24):3555-3572. doi: 10.15252/embj.201797876. Epub 2017 Nov 13. 10.15252/embj.201797876 PubMed 29133469