pRSF-T20S
(Plasmid
#110805)
-
Purposeexpresses Thermoplasma acidophilium 20S proteasome in E. Coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110805 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRSF
-
Backbone manufacturerNovagen
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namePsmB
-
MutationN2D
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- tev-His (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer GATCAGACTTTAGAAACTGG
- 3′ sequencing primer AACTCGAGTTAGTGGTGGTGGTGGTGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePsmA
-
MutationQ2E
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer TATGGCTAGCATGACTGGT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSF-T20S was a gift from Yifan Cheng (Addgene plasmid # 110805 ; http://n2t.net/addgene:110805 ; RRID:Addgene_110805) -
For your References section:
Allosteric coupling between alpha-rings of the 20S proteasome. Yu Z, Yu Y, Wang F, Myasnikov AG, Coffino P, Cheng Y. Nat Commun. 2020 Sep 11;11(1):4580. doi: 10.1038/s41467-020-18415-7. 10.1038/s41467-020-18415-7 PubMed 32917864