Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pRSF-T20S
(Plasmid #110805)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 110805 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    PsmB
  • Mutation
    N2D
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • tev-His (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer GATCAGACTTTAGAAACTGG
  • 3′ sequencing primer AACTCGAGTTAGTGGTGGTGGTGGTGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    PsmA
  • Mutation
    Q2E
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer TATGGCTAGCATGACTGGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSF-T20S was a gift from Yifan Cheng (Addgene plasmid # 110805 ; http://n2t.net/addgene:110805 ; RRID:Addgene_110805)
  • For your References section:

    Allosteric coupling between alpha-rings of the 20S proteasome. Yu Z, Yu Y, Wang F, Myasnikov AG, Coffino P, Cheng Y. Nat Commun. 2020 Sep 11;11(1):4580. doi: 10.1038/s41467-020-18415-7. 10.1038/s41467-020-18415-7 PubMed 32917864