pNTK Gatad2a flox
(Plasmid
#110812)
-
PurposeDonor targeting vector for generating mouse Gatad2a conditional knockout allele
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110812 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepNTK
- Total vector size (bp) 7828
-
Vector typeUnspecified
-
Selectable markersNeomycin (select with G418) ; TK
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemGataD2a
-
Alt namep66a
-
SpeciesM. musculus (mouse)
-
Entrez GeneGatad2a (a.k.a. 1110066C11Rik)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site SmaI (unknown if destroyed)
- 5′ sequencing primer gtgggttagggacggggtcc
- 3′ sequencing primer gcgacacggaaatgttgaat
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNTK Gatad2a flox was a gift from Jacob Hanna (Addgene plasmid # 110812 ; http://n2t.net/addgene:110812 ; RRID:Addgene_110812) -
For your References section:
Neutralizing Gatad2a-Chd4-Mbd3/NuRD Complex Facilitates Deterministic Induction of Naive Pluripotency. Mor N, Rais Y, Sheban D, Peles S, Aguilera-Castrejon A, Zviran A, Elinger D, Viukov S, Geula S, Krupalnik V, Zerbib M, Chomsky E, Lasman L, Shani T, Bayerl J, Gafni O, Hanna S, Buenrostro JD, Hagai T, Masika H, Vainorius G, Bergman Y, Greenleaf WJ, Esteban MA, Elling U, Levin Y, Massarwa R, Merbl Y, Novershtern N, Hanna JH. Cell Stem Cell. 2018 Sep 6;23(3):412-425.e10. doi: 10.1016/j.stem.2018.07.004. Epub 2018 Aug 16. 10.1016/j.stem.2018.07.004 PubMed 30122475