-
PurposePiggyBac compatible plasmid expressing dCas9-KRAB-MeCP2
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110824 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepB-CAGGS
- Total vector size (bp) 12882
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-KRAB-MeCP2
-
Alt namedCas9-KM
-
SpeciesSynthetic
-
Insert Size (bp)5300
-
MutationCas9 mutations to make dCas9=D10A+D839A+H840A+N863A
- Promoter CAGGS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGTACTTCGACACCACCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB-CAGGS-dCas9-KRAB-MeCP2 was a gift from Alejandro Chavez & George Church (Addgene plasmid # 110824 ; http://n2t.net/addgene:110824 ; RRID:Addgene_110824) -
For your References section:
An enhanced CRISPR repressor for targeted mammalian gene regulation. Yeo NC, Chavez A, Lance-Byrne A, Chan Y, Menn D, Milanova D, Kuo CC, Guo X, Sharma S, Tung A, Cecchi RJ, Tuttle M, Pradhan S, Lim ET, Davidsohn N, Ebrahimkhani MR, Collins JJ, Lewis NE, Kiani S, Church GM. Nat Methods. 2018 Jul 16. pii: 10.1038/s41592-018-0048-5. doi: 10.1038/s41592-018-0048-5. 10.1038/s41592-018-0048-5 PubMed 30013045