Skip to main content

pUG-natNT2
(Plasmid #110922)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110922 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUG6
  • Backbone manufacturer
    Gueldener et al Nucleic Acid Res 30(6):e23. 11884642
  • Backbone size w/o insert (bp) 4009
  • Total vector size (bp) 3852
  • Modifications to backbone
    The natNT2 marker was cloned from pFA6a-natNT2 (Janke et al., 2004) to pUG6 via the SacI and BglII restriction sites, thereby replacing the KanMX4 marker, resulting inpUG-natNT2.
  • Vector type
    Bacterial Expression, Yeast Expression
  • Selectable markers
    nourseothricin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nat
  • Species
    Streptomyces noursei
  • Insert Size (bp)
    576
  • GenBank ID
    ABB59019.1
  • Promoter AgTEF1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer CCAGCTGAAGCTTCGTACGC
  • 3′ sequencing primer GCATAGGCCACTAGTGGATCTG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Janke C, Magiera MM, Rathfelder N, Taxis C, Reber S, Maekawa H, Moreno-Borchart A, Doenges G, Schwob E, Schiebel E, Knop M. A versatile toolbox for PCR-based tagging of yeast genes: new fluorescent proteins, more markers and promoter substitution cassettes. Yeast. 2004 Aug;21(11):947-62.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUG-natNT2 was a gift from Jean-Marc Daran (Addgene plasmid # 110922 ; http://n2t.net/addgene:110922 ; RRID:Addgene_110922)
  • For your References section:

    Genome editing in Kluyveromyces and Ogataea yeasts using a broad-host-range Cas9/gRNA co-expression plasmid. Juergens H, Varela JA, Gorter de Vries AR, Perli T, Gast VJM, Gyurchev NY, Rajkumar AS, Mans R, Pronk JT, Morrissey JP, Daran JG. FEMS Yeast Res. 2018 May 1;18(3). pii: 4847887. doi: 10.1093/femsyr/foy012. 10.1093/femsyr/foy012 PubMed 29438517