Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-hSyn-DIO {mCAR}off-{DTR-GFP}on-WPRE
(Plasmid #111395)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 111395 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4825
  • Total vector size (bp) 7287
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Stbl3
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mCAR
  • Alt name
    mouse CAR variant 2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1056
  • GenBank ID
    NM_009988
  • Entrez Gene
    Cxadr (a.k.a. 2610206D03Rik, CAR, MCAR, MCVADR)
  • Promoter hSynapsin
  • Tag / Fusion Protein
    • Myc (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site PacI (not destroyed)
  • 5′ sequencing primer CCAAATTGCGCATCCCCTATC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    DTR-EGFP
  • Alt name
    diphtheria toxin receptor
  • Insert Size (bp)
    1362
  • Promoter hSynapsin
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site SpeI (destroyed during cloning)
  • 5′ sequencing primer CATGGCTGGCAGAAATGACG
  • 3′ sequencing primer GCAGCGTATCCACATAGCG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Backbone comes from plasmid pAAV-Ef1a-DIO-{ChETA-EYFP} (Addgene, Plasmid #26968)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-DIO {mCAR}off-{DTR-GFP}on-WPRE was a gift from Adam Kepecs (Addgene plasmid # 111395 ; http://n2t.net/addgene:111395 ; RRID:Addgene_111395)
  • For your References section:

    A Viral Receptor Complementation Strategy to Overcome CAV-2 Tropism for Efficient Retrograde Targeting of Neurons. Li SJ, Vaughan A, Sturgill JF, Kepecs A. Neuron. 2018 Jun 6;98(5):905-917.e5. doi: 10.1016/j.neuron.2018.05.028. 10.1016/j.neuron.2018.05.028 PubMed 29879392