-
PurposeExpresses full length PARP1 in Sf9 (insect) cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111572 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepACEBac1
-
Modifications to backboneC-terminal Flag-6xHis
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePARP1
-
Alt namePoly(ADP-ribose) polymerase 1
-
Alt nameARTD1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3042
-
Entrez GenePARP1 (a.k.a. ADPRT, ADPRT 1, ADPRT1, ARTD1, PARP, PARP-1, PARS, PPOL, Poly-PARP, pADPRT-1)
- Promoter polyhedrin promoter
-
Tags
/ Fusion Proteins
- C-terminal 6xHis (C terminal on backbone)
- C-terminal Flag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (on insert), BamHI (in vector) (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer Custom (gtatcgattcgcgacctactcc)
- 3′ sequencing primer SV40pA-R (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACEBac1-PARP1-Flag-His-WT was a gift from Thomas Muir (Addgene plasmid # 111572 ; http://n2t.net/addgene:111572 ; RRID:Addgene_111572) -
For your References section:
Acetylation blocks DNA damage-induced chromatin ADP-ribosylation. Liszczak G, Diehl KL, Dann GP, Muir TW. Nat Chem Biol. 2018 Jul 16. pii: 10.1038/s41589-018-0097-1. doi: 10.1038/s41589-018-0097-1. 10.1038/s41589-018-0097-1 PubMed 30013063