-
PurposeSleeping Beauty transposon containing SV-40-driven Venus-LEQLE-SIINFEKL-TEW for antigen presentation studies
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111624 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepT2/SV-Neo
-
Backbone manufacturerAddgene # 26553
- Total vector size (bp) 5057
-
Modifications to backboneThe Neo cassette was removed and Venus was cloned via SmaI/BstBI. Then, a well-flanked SIINFEKL was cloned by PCR mutagenesis at the C-terminus of Venus. The Sleeping Beauty transposon sequences are intact.
-
Vector typeMammalian Expression
-
Selectable markersVenus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVenus-LEQLE-SIINFEKL-TEW
-
Alt nameVenus-SL8
-
Alt nameVenus-SIINFEKL
-
Insert Size (bp)768
- Promoter SV40
-
Tag
/ Fusion Protein
- LEQLE-SIINFEKL-TEW (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (not destroyed)
- 3′ cloning site BstBI (not destroyed)
- 5′ sequencing primer TATTTATGCAGAGGCCGAGG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT2/SV-Venus-SIINFEKL was a gift from Jon Yewdell (Addgene plasmid # 111624 ; http://n2t.net/addgene:111624 ; RRID:Addgene_111624)