Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pT2/SV-Venus-SIINFEKL
(Plasmid #111624)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 111624 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pT2/SV-Neo
  • Backbone manufacturer
    Addgene # 26553
  • Total vector size (bp) 5057
  • Modifications to backbone
    The Neo cassette was removed and Venus was cloned via SmaI/BstBI. Then, a well-flanked SIINFEKL was cloned by PCR mutagenesis at the C-terminus of Venus. The Sleeping Beauty transposon sequences are intact.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Venus

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Venus-LEQLE-SIINFEKL-TEW
  • Alt name
    Venus-SL8
  • Alt name
    Venus-SIINFEKL
  • Insert Size (bp)
    768
  • Promoter SV40
  • Tag / Fusion Protein
    • LEQLE-SIINFEKL-TEW (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (not destroyed)
  • 3′ cloning site BstBI (not destroyed)
  • 5′ sequencing primer TATTTATGCAGAGGCCGAGG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT2/SV-Venus-SIINFEKL was a gift from Jon Yewdell (Addgene plasmid # 111624 ; http://n2t.net/addgene:111624 ; RRID:Addgene_111624)