pMV306-ribo-APEX2
(Plasmid
#111700)
-
PurposeTheophylline-inducible expression of APEX2 from a mycobacterial shuttle plasmid (integrating)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111700 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMV306
- Total vector size (bp) 5052
-
Modifications to backboneDerivative of pMV306 in which promoter has been modified to include theophylline-inducible riboswitch. See reference: Seeliger JC, Topp S, Sogi KM, Previti ML, Gallivan JP, Bertozzi CR. A riboswitch-based inducible gene expression system for mycobacteria. PLoS ONE. 2012;7(1):e29266. PMCID: 3261144
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAPEX2
-
Insert Size (bp)801
- Promoter hsp60-ribo
-
Tag
/ Fusion Protein
- V5 (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCCTTTGAGTGAGCTGATACC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAlice Ting (pcDNA3-mito-APEX, Addgene plasmid #42607)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is for theophylline-inducible expression of APEX2 in the cytoplasm of mycobacteria. It is a single-copy integrating vector in mycobacteria. The APEX gene was subcloned from pcDNA3-mito-APEX and subsequently mutated by site-directed mutagenesis to generate the optimized variant APEX2.
See also references: Rhee HW, Zou P, Udeshi ND, Martell JD, Mootha VK, Carr SA, Ting AY. Proteomic mapping of mitochondria in living cells via spatially restricted enzymatic tagging. Science. 2013;339(6125):1328-31. PMCID: 3916822.
Lam SS, Martell JD, Kamer KJ, Deerinck TJ, Ellisman MH, Mootha VK, Ting AY. Directed evolution of APEX2 for electron microscopy and proximity labeling. Nat Methods. 2015;12(1):51-4. PMCID: 4296904
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMV306-ribo-APEX2 was a gift from Jessica Seeliger (Addgene plasmid # 111700 ; http://n2t.net/addgene:111700 ; RRID:Addgene_111700) -
For your References section:
Compartment-Specific Labeling of Bacterial Periplasmic Proteins by Peroxidase-Mediated Biotinylation. Ganapathy US, Bai L, Wei L, Eckartt KA, Lett CM, Previti ML, Carrico IS, Seeliger JC. ACS Infect Dis. 2018 Apr 30. doi: 10.1021/acsinfecdis.8b00044. 10.1021/acsinfecdis.8b00044 PubMed 29708735