pCRISPR_eGFP_191
(Plasmid
#111821)
-
PurposeKnockout eGFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111821 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAll_in_one_CRISPR/Cas9_LacZ
-
Backbone manufacturerLynne Postovit (Addgene plasmid # 74293)
- Backbone size w/o insert (bp) 10694
- Total vector size (bp) 10394
-
Modifications to backboneRemoval of LacZ-alpha in the cloning process
-
Vector typeMammalian Expression, Bacterial Expression, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA targeting eGFP 171-191
-
gRNA/shRNA sequenceACTGCACGCCGTAGGTCAGGG
-
SpeciesH. sapiens (human), Synthetic
- Promoter U6
-
Tag
/ Fusion Protein
- mCherry
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer SP6 Forward: ATTTAGGTGACACTATAGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPR_eGFP_191 was a gift from Steve Shih (Addgene plasmid # 111821 ; http://n2t.net/addgene:111821 ; RRID:Addgene_111821) -
For your References section:
An automated microfluidic gene-editing platform for deciphering cancer genes. Sinha H, Quach ABV, Vo PQN, Shih SCC. Lab Chip. 2018 Jul 24;18(15):2300-2312. doi: 10.1039/c8lc00470f. 10.1039/c8lc00470f PubMed 29989627