Skip to main content

pEGFP-N1-IL6
(Plasmid #111933)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111933 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Interleukin 6
  • Alt name
    IL-6
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    647
  • Mutation
    Codon optimized for expression in human cells
  • GenBank ID
    NM_000600.4
  • Entrez Gene
    IL6 (a.k.a. BSF-2, BSF2, CDF, HGF, HSF, IFN-beta-2, IFNB2, IL-6)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAACAACTCCGCCCCATT
  • 3′ sequencing primer GTCCAGCTCGACCAGGATGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Synthetic gene from Genscript
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-N1-IL6 was a gift from Geert van den Bogaart (Addgene plasmid # 111933 ; http://n2t.net/addgene:111933 ; RRID:Addgene_111933)
  • For your References section:

    Interleukin-6 secretion is limited by self-signaling in endosomes. Verboogen DRJ, Revelo NH, Ter Beest M, van den Bogaart G. J Mol Cell Biol. 2018 Jul 16. pii: 5054600. doi: 10.1093/jmcb/mjy038. 10.1093/jmcb/mjy038 PubMed 30016456