-
Purposelenti vector encoding dcas9-3xflag with T2A Blastcidin resistance marker (EF1a-NLS-dCas9-3Xflag-T2A-Blast-WPRE)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112133 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonelenti dCAS-VP64_Blast
-
Backbone manufacturerZhang lab (Addgene plasmid #61425)
- Backbone size w/o insert (bp) 13989
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9(D10A, N863A)-T2A-Blast
-
SpeciesSynthetic
-
Insert Size (bp)4779
-
MutationD10A and N863A mutants in Cas9
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTCAGACAGTGGTTCAAAG
- 3′ sequencing primer GTCGTGGTCCTTATAGTCCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
from addgene 61425, BamHI and EcoRI digested followed by ligate with 3xFlag tag.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLL7 lenti-dcas9-3xflag-blast was a gift from Fei-Long Meng (Addgene plasmid # 112133 ; http://n2t.net/addgene:112133 ; RRID:Addgene_112133) -
For your References section:
Intrinsic Nucleotide Preference of Diversifying Base Editors Guides Antibody Ex Vivo Affinity Maturation. Liu LD, Huang M, Dai P, Liu T, Fan S, Cheng X, Zhao Y, Yeap LS, Meng FL. Cell Rep. 2018 Oct 23;25(4):884-892.e3. doi: 10.1016/j.celrep.2018.09.090. 10.1016/j.celrep.2018.09.090 PubMed 30355495