Skip to main content

pLL7 lenti-dcas9-3xflag-blast
(Plasmid #112133)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112133 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lenti dCAS-VP64_Blast
  • Backbone manufacturer
    Zhang lab (Addgene plasmid #61425)
  • Backbone size w/o insert (bp) 13989
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9(D10A, N863A)-T2A-Blast
  • Species
    Synthetic
  • Insert Size (bp)
    4779
  • Mutation
    D10A and N863A mutants in Cas9
  • Promoter EF1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCTCAGACAGTGGTTCAAAG
  • 3′ sequencing primer GTCGTGGTCCTTATAGTCCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

from addgene 61425, BamHI and EcoRI digested followed by ligate with 3xFlag tag.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLL7 lenti-dcas9-3xflag-blast was a gift from Fei-Long Meng (Addgene plasmid # 112133 ; http://n2t.net/addgene:112133 ; RRID:Addgene_112133)
  • For your References section:

    Intrinsic Nucleotide Preference of Diversifying Base Editors Guides Antibody Ex Vivo Affinity Maturation. Liu LD, Huang M, Dai P, Liu T, Fan S, Cheng X, Zhao Y, Yeap LS, Meng FL. Cell Rep. 2018 Oct 23;25(4):884-892.e3. doi: 10.1016/j.celrep.2018.09.090. 10.1016/j.celrep.2018.09.090 PubMed 30355495