Skip to main content

pX458-ECFP
(Plasmid #112220)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112220 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-GFP (PX458)
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 48138)
  • Total vector size (bp) 9300
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ECFP
  • Species
    Synthetic
  • Insert Size (bp)
    717

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CCTGCCGCCTTCAAGTACTT
  • 3′ sequencing primer GGAAAGGACAGTGGGAGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX458-ECFP was a gift from Yinming Liang (Addgene plasmid # 112220 ; http://n2t.net/addgene:112220 ; RRID:Addgene_112220)
  • For your References section:

    Speed genome editing by transient CRISPR/Cas9 targeting and large DNA fragment deletion. Luo J, Lu L, Gu Y, Huang R, Gui L, Li S, Qi X, Zheng W, Chao T, Zheng Q, Liang Y, Zhang L. J Biotechnol. 2018 Jun 7;281:11-20. doi: 10.1016/j.jbiotec.2018.06.308. 10.1016/j.jbiotec.2018.06.308 PubMed 29886029