SLF091: Lenti-CaMKIIa-eTsChR-eGFP
(Plasmid
#112281)
-
PurposeFor lentiviral or direct expression of eTsChR in excitatory neurons
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112281 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonefck-WPRE
- Backbone size w/o insert (bp) 9300
- Total vector size (bp) 10900
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeTsChR
-
SpeciesSynthetic
-
Insert Size (bp)1600
- Promoter CaMKIIa
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTCGTCAATCAAGCTGGTTC
- 3′ sequencing primer tcacaaattttgtaatccag
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SLF091: Lenti-CaMKIIa-eTsChR-eGFP was a gift from Adam Cohen (Addgene plasmid # 112281 ; http://n2t.net/addgene:112281 ; RRID:Addgene_112281) -
For your References section:
Wide-area all-optical neurophysiology in acute brain slices. Farhi SL, Parot VJ, Grama A, Yamagata M, Abdelfattah AS, Adam Y, Lou S, Jun Kim J, Campbell RE, Cox DD, Cohen AE. J Neurosci. 2019 Apr 5. pii: JNEUROSCI.0168-19.2019. doi: 10.1523/JNEUROSCI.0168-19.2019. 10.1523/JNEUROSCI.0168-19.2019 PubMed 30952812