Skip to main content
Addgene

SLF091: Lenti-CaMKIIa-eTsChR-eGFP
(Plasmid #112281)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112281 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    fck-WPRE
  • Backbone size w/o insert (bp) 9300
  • Total vector size (bp) 10900
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eTsChR
  • Species
    Synthetic
  • Insert Size (bp)
    1600
  • Promoter CaMKIIa
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCTCGTCAATCAAGCTGGTTC
  • 3′ sequencing primer tcacaaattttgtaatccag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SLF091: Lenti-CaMKIIa-eTsChR-eGFP was a gift from Adam Cohen (Addgene plasmid # 112281 ; http://n2t.net/addgene:112281 ; RRID:Addgene_112281)
  • For your References section:

    Wide-area all-optical neurophysiology in acute brain slices. Farhi SL, Parot VJ, Grama A, Yamagata M, Abdelfattah AS, Adam Y, Lou S, Jun Kim J, Campbell RE, Cox DD, Cohen AE. J Neurosci. 2019 Apr 5. pii: JNEUROSCI.0168-19.2019. doi: 10.1523/JNEUROSCI.0168-19.2019. 10.1523/JNEUROSCI.0168-19.2019 PubMed 30952812