Skip to main content

pLBH531_MBP-Cas14a1 expression
(Plasmid #112500)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112500 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMBP
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas14a1
  • Alt name
    Un1Cas12f1
  • Insert Size (bp)
    1590
  • Promoter T7
  • Tag / Fusion Protein
    • 10xHis-MBP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATGAAGCCCTGAAAGACGCGCAG
  • 3′ sequencing primer CTA GTT ATT GCT CAG CGG T
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLBH531_MBP-Cas14a1 expression was a gift from Jennifer Doudna (Addgene plasmid # 112500 ; http://n2t.net/addgene:112500 ; RRID:Addgene_112500)
  • For your References section:

    Programmed DNA destruction by miniature CRISPR-Cas14 enzymes. Harrington LB, Burstein D, Chen JS, Paez-Espino D, Ma E, Witte IP, Cofsky JC, Kyrpides NC, Banfield JF, Doudna JA. Science. 2018 Oct 18. pii: science.aav4294. doi: 10.1126/science.aav4294. 10.1126/science.aav4294 PubMed 30337455