Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMBP-LbCas12a
(Plasmid #113431)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 113431 Standard format: Plasmid sent in bacteria as agar stab 1 $75
Cloning Grade DNA 113431-DNA.cg 2 µg of cloning grade DNA in Tris buffer 1 $95

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LbCas12a
  • Insert Size (bp)
    3684
  • Promoter T7
  • Tag / Fusion Protein
    • MBP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATGAAGCCCTGAAAGACGCGCAG
  • 3′ sequencing primer CTA GTT ATT GCT CAG CGG T
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid

Information for Cloning Grade DNA (Catalog # 113431-DNA.cg) ( Back to top )

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

  • Amount 2 µg
  • Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
  • Pricing $95 USD
  • Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMBP-LbCas12a was a gift from Jennifer Doudna (Addgene plasmid # 113431 ; http://n2t.net/addgene:113431 ; RRID:Addgene_113431)
  • For your References section:

    CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Chen JS, Ma E, Harrington LB, Da Costa M, Tian X, Palefsky JM, Doudna JA. Science. 2018 Apr 27;360(6387):436-439. doi: 10.1126/science.aar6245. Epub 2018 Feb 15. 10.1126/science.aar6245 PubMed 29449511